Variant
RS1 G74_D79delinsVPX
NM_000330.4(RS1):c.221_237delinsTCCCCTGACCGGGTTAGAGT (p.Gly74_Asp79delinsValProTer)
- p.Gly74_Asp79delinsValProTer
- p.G74_D79delinsVP*
- rs1555957756
- ClinVar classification
- Pathogenic
- Review status
- 3 stars out of 4reviewed by expert panel
- Last evaluated
- 19 May 2025
- Expert panel
- ClinGen X-linked Inherited Retinal Disease Variant Curation Expert Panel, ClinGen
Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.16-c6eea6bfFacts last changed 16 October 2026
Reference genomeGRCh38hg38
Positions on gene and variant pages follow this choice, in this browser.
Summary
G74_D79delinsVPX is a nonsense variant in RS1: it creates an early stop signal, so the protein the gene encodes is predicted to be cut short. ClinVar classifies it as pathogenic for X-linked retinoschisis (reviewed by expert panel).
ClinVar classifications
| Condition | Classification | Review status | Submissions | Last evaluated |
|---|---|---|---|---|
| X-linked retinoschisisClinVar VCV000449509 (opens in a new tab) | Pathogenic | 3 stars out of 4reviewed by expert panel | 1 submission | 19 May 2025 |
Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed.
Where it lies in RS1
G74_D79delinsVPX lies in exon 4 of the 6 in RS1's MANE Select transcript, NM_000330.4.
Molecular details
| Gene | RS1 |
|---|---|
| Transcript | NM_000330.4MANE Select |
| Coding DNA change (HGVS c.) | c.221_237delinsTCCCCTGACCGGGTTAGAGT |
| Protein change (HGVS p.) | p.Gly74_Asp79delinsValProTerp.G74_D79delinsVP* |
| Predicted consequence | Nonsense (stop gained)stop_gained (opens in a new tab)protein_altering_variant (opens in a new tab) |
| Predicted impact | High |
| Position (GRCh38) | chrX:18647280 GTCCGGTGTGACCTCCC>ACTCTAACCCGGTCAGGGGA |
| Position (GRCh37) | chrX:18665400 GTCCGGTGTGACCTCCC>ACTCTAACCCGGTCAGGGGA |
| dbSNP ID | rs1555957756 (opens in a new tab) |
| ClinVar Variation ID | VCV000449509 (opens in a new tab) |
| ClinVar Allele ID | 446602 |
| ClinGen Allele Registry ID | CA658658931 (opens in a new tab) |
| ClinVar name | NM_000330.4(RS1):c.221_237delinsTCCCCTGACCGGGTTAGAGT (p.Gly74_Asp79delinsValProTer) |
RS1 G74_D79delinsVPX in other databases
Reports that look at this variant (1)
These Genome Test condition reports include G74_D79delinsVPX among the variants they look at.
| Report | Conditions | Inheritance |
|---|---|---|
| Vitreoretinopathy | Vitreoretinal Degeneration |
Other variants in RS1
- A18TPathogenic3 stars out of 4
- c.1A>TPathogenic3 stars out of 4
- c.52+1G>APathogenic3 stars out of 4
- c.52+1G>CPathogenic3 stars out of 4
- c.52+1G>TPathogenic3 stars out of 4
- c.52+2T>APathogenic3 stars out of 4
- c.52+2T>CPathogenic3 stars out of 4
- c.53-1G>APathogenic3 stars out of 4
- c.53-713_78+266delLikely pathogenic3 stars out of 4
- c.78+1G>APathogenic3 stars out of 4
Limitations
This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant.
Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports.
Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements.
If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor.
Sources & credits
- Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information.
- Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0.
- Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16).
- Allele identifiers from the ClinGen Allele Registry (release 2026-10-16-c4908f54).
- Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information.
- Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-16).
- Difficult regions from the Genome in a Bottle Consortium (release v3.6).
- Transcripts from MANE (release v1.5), NCBI and EMBL-EBI.
- Predicted consequences from mehari (release 0.11.0), with transcript models from cdot.
- Built from Dante Labs data release 2026.10.16-c6eea6bf of 16 October 2026.
Cite this page
Dante Labs. (16 October 2026). RS1 G74_D79delinsVPX (c.221_237delinsTCCCCTGACCGGGTTAGAGT, rs1555957756) (Version 2026.10.16-c6eea6bf). Retrieved 16 October 2026, from https://dantelabs.com/genes/rs1/variants/g74-d79delinsvpx
Dante Labs. RS1 G74_D79delinsVPX (c.221_237delinsTCCCCTGACCGGGTTAGAGT, rs1555957756) [Internet]. Version 2026.10.16-c6eea6bf. 16 October 2026 [cited 16 October 2026]. Available from: https://dantelabs.com/genes/rs1/variants/g74-d79delinsvpx
Read your whole genome
From $449Free shipping · Results in 6–8 weeks