Variant
RMRP n.2_3insCTCTGTGAAGCTGAGGACGTGG
NR_003051.3(RMRP):n.2_3insCTCTGTGAAGCTGAGGACGTGG
- rs1587919053
- ClinVar classification
- Likely pathogenic
- Review status
- 3 stars out of 4reviewed by expert panel
- Last evaluated
- 7 October 2025
- Expert panel
- ClinGen Severe Combined Immunodeficiency Variant Curation Expert Panel, ClinGen
Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.16-c6eea6bfFacts last changed 16 October 2026
Reference genomeGRCh38hg38
Positions on gene and variant pages follow this choice, in this browser.
Summary
n.2_3insCTCTGTGAAGCTGAGGACGTGG is a variant in RMRP. ClinVar classifies it as likely pathogenic for cartilage-hair hypoplasia (reviewed by expert panel).
ClinVar classifications
| Condition | Classification | Review status | Submissions | Last evaluated |
|---|---|---|---|---|
| cartilage-hair hypoplasiaClinVar VCV000660541 (opens in a new tab) | Likely pathogenic | 3 stars out of 4reviewed by expert panel | 1 submission | 7 October 2025 |
Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed.
Where it lies in RMRP
n.2_3insCTCTGTGAAGCTGAGGACGTGG lies in exon 1 of the 1 in RMRP's MANE Select transcript, NR_003051.4.
Molecular details
| Gene | RMRP |
|---|---|
| Transcript | NR_003051.3 |
| Coding DNA change (HGVS c.) | n.2_3insCTCTGTGAAGCTGAGGACGTGG |
| Predicted consequence | Othernon_coding_transcript_exon_variant (opens in a new tab) |
| Predicted impact | Modifier |
| Position (GRCh38) | chr9:35658016 A>ACCACGTCCTCAGCTTCACAGAG |
| Position (GRCh37) | chr9:35658013 A>ACCACGTCCTCAGCTTCACAGAG |
| dbSNP ID | rs1587919053 (opens in a new tab) |
| ClinVar Variation ID | VCV000660541 (opens in a new tab) |
| ClinVar Allele ID | 651930 |
| ClinGen Allele Registry ID | CA915947439 (opens in a new tab) |
| ClinVar name | NC_000009.12:g.35658017_35658038dup |
RMRP n.2_3insCTCTGTGAAGCTGAGGACGTGG in other databases
Reports that look at this variant (2)
These Genome Test condition reports include n.2_3insCTCTGTGAAGCTGAGGACGTGG among the variants they look at.
| Report | Conditions | Inheritance |
|---|---|---|
| Immuno-Osseous Dysplasias | Immuno-osseous dysplasia | Autosomal recessive |
| Other Inborn Errors of Immunity | Inborn error of immunity |
Other variants in RMRP
- n.3_4insGAAGCTGAGGACGTGGTPathogenic3 stars out of 4
- n.36C>ALikely pathogenic3 stars out of 4
- n.36C>TLikely pathogenic3 stars out of 4
- n.147G>ALikely pathogenic3 stars out of 4
- n.181G>ALikely pathogenic3 stars out of 4
- n.194G>A193G-ALikely pathogenic3 stars out of 4
- n.196C>T195C-TPathogenic3 stars out of 4
- n.212C>GLikely pathogenic3 stars out of 4
- n.219A>G218A-GLikely pathogenic3 stars out of 4
- n.221T>CLikely pathogenic3 stars out of 4
Limitations
This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant.
Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports.
Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements.
If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor.
Sources & credits
- Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information.
- Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0.
- Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16).
- Allele identifiers from the ClinGen Allele Registry (release 2026-10-16-c4908f54).
- Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information.
- Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-16).
- Difficult regions from the Genome in a Bottle Consortium (release v3.6).
- Transcripts from MANE (release v1.5), NCBI and EMBL-EBI.
- Predicted consequences from mehari (release 0.11.0), with transcript models from cdot.
- Built from Dante Labs data release 2026.10.16-c6eea6bf of 16 October 2026.
Cite this page
Dante Labs. (16 October 2026). RMRP n.2_3insCTCTGTGAAGCTGAGGACGTGG (rs1587919053) (Version 2026.10.16-c6eea6bf). Retrieved 16 October 2026, from https://dantelabs.com/genes/rmrp/variants/n-2to3insctctgtgaagctgaggacgtgg
Dante Labs. RMRP n.2_3insCTCTGTGAAGCTGAGGACGTGG (rs1587919053) [Internet]. Version 2026.10.16-c6eea6bf. 16 October 2026 [cited 16 October 2026]. Available from: https://dantelabs.com/genes/rmrp/variants/n-2to3insctctgtgaagctgaggacgtgg
Read your whole genome
From $449Free shipping · Results in 6–8 weeks