Variant
MLH1 c.885-207_996del
NM_000249.4(MLH1):c.885-207_996del (p.?)
- p.?
- rs1553647795
- ClinVar classification
- Pathogenic
- Review status
- 3 stars out of 4reviewed by expert panel
- Last evaluated
- 5 September 2013
- Expert panel
- International Society for Gastrointestinal Hereditary Tumours (InSiGHT)
Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.16-c6eea6bfFacts last changed 16 October 2026
Reference genomeGRCh38hg38
Positions on gene and variant pages follow this choice, in this browser.
Summary
c.885-207_996del is a splice variant in MLH1: it sits at or near a boundary between an exon and an intron, where it may change how the gene's RNA is put together. ClinVar classifies it as pathogenic for Lynch Syndrome (reviewed by expert panel).
ClinVar classifications
| Condition | Classification | Review status | Submissions | Last evaluated |
|---|---|---|---|---|
| Lynch SyndromeClinVar VCV000090419 (opens in a new tab) | Pathogenic | 3 stars out of 4reviewed by expert panel | 1 submission | 5 September 2013 |
Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed.
Where it lies in MLH1
c.885-207_996del lies in intron 10, between exons 10 and 11 of the 19 in MLH1's MANE Select transcript, NM_000249.4.
Molecular details
| Gene | MLH1 |
|---|---|
| Transcript | NM_000249.4MANE Select |
| Coding DNA change (HGVS c.) | c.885-207_996del |
| Protein change (HGVS p.) | p.? |
| Predicted consequence | Splice site or regionsplice_acceptor_variant (opens in a new tab)splice_region_variant (opens in a new tab)exonic_splice_region_variant (opens in a new tab)splice_polypyrimidine_tract_variant (opens in a new tab) |
| Predicted impact | High |
| Position (GRCh38) | chr3:37020102 GAGGCAAAGAAAGATGATGTAACTTACGCAAAGCTACACAGCTCTTAAGTAGCAGTGCCAATATTTGAACACACTCAGACTCGATCCTGAGGTTTTGACCACTGTGTCATCTGGCCTCAAATCTTCTGGCCACCACATACACCATATGTGGGCTTTTTCTCCCCCTCCCACTATCTAAGGTAATTGTTCTCTCTTATTTTCCTGACAGTTTAGAAATCAGTCCCCAGAATGTGGATGTTAATGTGCACCCCACAAAGCATGAAGTTCACTTCCTGCACGAGGAGAGCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGC>G |
| Position (GRCh37) | chr3:37061593 GAGGCAAAGAAAGATGATGTAACTTACGCAAAGCTACACAGCTCTTAAGTAGCAGTGCCAATATTTGAACACACTCAGACTCGATCCTGAGGTTTTGACCACTGTGTCATCTGGCCTCAAATCTTCTGGCCACCACATACACCATATGTGGGCTTTTTCTCCCCCTCCCACTATCTAAGGTAATTGTTCTCTCTTATTTTCCTGACAGTTTAGAAATCAGTCCCCAGAATGTGGATGTTAATGTGCACCCCACAAAGCATGAAGTTCACTTCCTGCACGAGGAGAGCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGC>G |
| dbSNP ID | rs1553647795 (opens in a new tab) |
| ClinVar Variation ID | VCV000090419 (opens in a new tab) |
| ClinVar Allele ID | 95893 |
| ClinGen Allele Registry ID | CA331159 (opens in a new tab) |
| ClinVar name | NM_000249.4(MLH1):c.885-206_997del |
MLH1 c.885-207_996del in other databases
- ClinVar VCV000090419 (opens in a new tab)
- dbSNP rs1553647795 (opens in a new tab)
- ClinGen Allele Registry CA331159 (opens in a new tab)
- gnomAD 3-37020102-GAGGCAAAGAAAGATGATGTAACTTACGCAAAGCTACACAGCTCTTAAGTAGCAGTGCCAATATTTGAACACACTCAGACTCGATCCTGAGGTTTTGACCACTGTGTCATCTGGCCTCAAATCTTCTGGCCACCACATACACCATATGTGGGCTTTTTCTCCCCCTCCCACTATCTAAGGTAATTGTTCTCTCTTATTTTCCTGACAGTTTAGAAATCAGTCCCCAGAATGTGGATGTTAATGTGCACCCCACAAAGCATGAAGTTCACTTCCTGCACGAGGAGAGCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGC-G (opens in a new tab)
- Ensembl rs1553647795 (opens in a new tab)
Reports that look at this variant (1)
These Genome Test condition reports include c.885-207_996del among the variants they look at.
| Report | Conditions | Inheritance |
|---|---|---|
| Lynch Syndrome | Lynch Syndrome | Autosomal dominant |
Other variants in MLH1
- A21EPathogenic3 stars out of 4
- A21Rfs*15Pathogenic3 stars out of 4
- A21VPathogenic3 stars out of 4
- A29GPathogenic3 stars out of 4
- A29Lfs*7Pathogenic3 stars out of 4
- A111VLikely pathogenic3 stars out of 4
- A125Ifs*15Pathogenic3 stars out of 4
- A128PPathogenic3 stars out of 4
- A128Qfs*8Pathogenic3 stars out of 4
- A128Sfs*6Pathogenic3 stars out of 4
Limitations
This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant.
Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports.
Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements.
If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor.
Sources & credits
- Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information.
- Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0.
- Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16).
- Allele identifiers from the ClinGen Allele Registry (release 2026-10-16-c4908f54).
- Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information.
- Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-16).
- Difficult regions from the Genome in a Bottle Consortium (release v3.6).
- Transcripts from MANE (release v1.5), NCBI and EMBL-EBI.
- Predicted consequences from mehari (release 0.11.0), with transcript models from cdot.
- Built from Dante Labs data release 2026.10.16-c6eea6bf of 16 October 2026.
Cite this page
Dante Labs. (16 October 2026). MLH1 c.885-207_996del (rs1553647795) (Version 2026.10.16-c6eea6bf). Retrieved 16 October 2026, from https://dantelabs.com/genes/mlh1/variants/c-885-207to996del
Dante Labs. MLH1 c.885-207_996del (rs1553647795) [Internet]. Version 2026.10.16-c6eea6bf. 16 October 2026 [cited 16 October 2026]. Available from: https://dantelabs.com/genes/mlh1/variants/c-885-207to996del
Read your whole genome
From $449Free shipping · Results in 6–8 weeks