Variant
CFTR c.2989-2_3137del
NM_000492.4(CFTR):c.2989-2_3137del (p.?)
- CFTRdele19
- p.?
- rs1562914028
- ClinVar classification
- Pathogenic
- Review status
- 3 stars out of 4reviewed by expert panel
- Last evaluated
- 17 March 2017
- Expert panel
- CFTR2
Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.16-c6eea6bfFacts last changed 16 October 2026
Reference genomeGRCh38hg38
Positions on gene and variant pages follow this choice, in this browser.
Summary
c.2989-2_3137del is a splice variant in CFTR: it sits at or near a boundary between an exon and an intron, where it may change how the gene's RNA is put together. ClinVar classifies it as pathogenic for Cystic Fibrosis (reviewed by expert panel).
ClinVar classifications
| Condition | Classification | Review status | Submissions | Last evaluated |
|---|---|---|---|---|
| Cystic FibrosisClinVar VCV000053616 (opens in a new tab) | Pathogenic | 3 stars out of 4reviewed by expert panel | 1 submission | 17 March 2017 |
Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed.
Where it lies in CFTR
c.2989-2_3137del lies in intron 18, between exons 18 and 19 of the 27 in CFTR's MANE Select transcript, NM_000492.4.
Molecular details
| Gene | CFTR |
|---|---|
| Transcript | NM_000492.4MANE Select |
| Coding DNA change (HGVS c.) | c.2989-2_3137del |
| Protein change (HGVS p.) | p.? |
| Predicted consequence | Splice site or regionsplice_acceptor_variant (opens in a new tab)exonic_splice_region_variant (opens in a new tab) |
| Predicted impact | High |
| Position (GRCh38) | chr7:117610516 CAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGA>C |
| Position (GRCh37) | chr7:117250570 CAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGA>C |
| dbSNP ID | rs1562914028 (opens in a new tab) |
| ClinVar Variation ID | VCV000053616 (opens in a new tab) |
| ClinVar Allele ID | 68284 |
| ClinGen Allele Registry ID | CA326999 (opens in a new tab) |
| ClinVar name | NC_000007.14:g.117610519_117610669del |
| Other names | CFTRdele19 |
CFTR c.2989-2_3137del in other databases
- ClinVar VCV000053616 (opens in a new tab)
- dbSNP rs1562914028 (opens in a new tab)
- ClinGen Allele Registry CA326999 (opens in a new tab)
- gnomAD 7-117610516-CAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGA-C (opens in a new tab)
- Ensembl rs1562914028 (opens in a new tab)
Reports that look at this variant (1)
These Genome Test condition reports include c.2989-2_3137del among the variants they look at.
| Report | Conditions | Inheritance |
|---|---|---|
| Cystic Fibrosis | Cystic Fibrosis | Autosomal recessive |
Other variants in CFTR
- A455EPathogenic4 stars out of 4
- c.489+1G>T621+1G>TPathogenic4 stars out of 4
- c.579+1G>T711+1G>TPathogenic4 stars out of 4
- c.1585-1G>A1717-1G->APathogenic4 stars out of 4
- c.1766+1G>A1898+1G>APathogenic4 stars out of 4
- c.2657+5G>A2789+5G>APathogenic4 stars out of 4
- c.2988+1G>A3120+1G>APathogenic4 stars out of 4
- c.3718-2477C>T3849+10kbC->TPathogenic4 stars out of 4
- F508delPathogenic4 stars out of 4
- G85EPathogenic4 stars out of 4
Limitations
This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant.
Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports.
Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements.
If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor.
Sources & credits
- Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information.
- Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0.
- Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16).
- Allele identifiers from the ClinGen Allele Registry (release 2026-10-16-c4908f54).
- Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information.
- Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-16).
- Difficult regions from the Genome in a Bottle Consortium (release v3.6).
- Transcripts from MANE (release v1.5), NCBI and EMBL-EBI.
- Predicted consequences from mehari (release 0.11.0), with transcript models from cdot.
- Built from Dante Labs data release 2026.10.16-c6eea6bf of 16 October 2026.
Cite this page
Dante Labs. (16 October 2026). CFTR c.2989-2_3137del (rs1562914028) (Version 2026.10.16-c6eea6bf). Retrieved 16 October 2026, from https://dantelabs.com/genes/cftr/variants/c-2989-2to3137del
Dante Labs. CFTR c.2989-2_3137del (rs1562914028) [Internet]. Version 2026.10.16-c6eea6bf. 16 October 2026 [cited 16 October 2026]. Available from: https://dantelabs.com/genes/cftr/variants/c-2989-2to3137del
Read your whole genome
From $449Free shipping · Results in 6–8 weeks