Skip to content
Use your HSA or FSA funds

Variant

BRCA1 c.5333-36_5406+400del

NM_007294.4(BRCA1):c.5333-36_5406+400del (p.?)

Also known as
  • IVS21-36del510
  • p.?
  • rs1555574977
ClinVar classification
Pathogenic
Review status
3 stars out of 4reviewed by expert panel
Last evaluated
11 June 2024
Expert panel
ClinGen ENIGMA BRCA1 and BRCA2 Variant Curation Expert Panel, ClinGen

Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.16-c6eea6bfFacts last changed 16 October 2026

Reference genomeGRCh38

Positions on gene and variant pages follow this choice, in this browser.

Summary

c.5333-36_5406+400del is a splice variant in BRCA1: it sits at or near a boundary between an exon and an intron, where it may change how the gene's RNA is put together. ClinVar classifies it as pathogenic for BRCA1-related cancer predisposition (reviewed by expert panel).

ClinVar classifications

ConditionClassificationReview statusSubmissionsLast evaluated
BRCA1-related cancer predispositionClinVar VCV000267601 (opens in a new tab)Pathogenic3 stars out of 4reviewed by expert panel1 submission11 June 2024

Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed.

Where it lies in BRCA1

c.5333-36_5406+400del lies in intron 21, between exons 21 and 22 of the 23 in BRCA1's MANE Select transcript, NM_007294.4.

c.5333-36_5406+400del marked on BRCA1's transcript43,048,720

BRCA1's gene diagram →

Molecular details

GeneBRCA1
TranscriptNM_007294.4MANE Select
Coding DNA change (HGVS c.)c.5333-36_5406+400del
Protein change (HGVS p.)p.?
Predicted consequenceSplice site or regionexon_loss_variantsplice_acceptor_variant (opens in a new tab)splice_donor_variant (opens in a new tab)splice_donor_5th_base_variant (opens in a new tab)splice_region_variant (opens in a new tab)exonic_splice_region_variant (opens in a new tab)splice_donor_region_variant (opens in a new tab)splice_polypyrimidine_tract_variant (opens in a new tab)
Predicted impactHigh
Position (GRCh38)chr17:43048720 CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA>C
Position (GRCh37)chr17:41200737 CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA>C
dbSNP IDrs1555574977 (opens in a new tab)
ClinVar Variation IDVCV000267601 (opens in a new tab)
ClinVar Allele ID262919
ClinGen Allele Registry IDCA10602571 (opens in a new tab)
ClinVar nameNM_007294.4(BRCA1):c.5333-36_5406+400del
Other namesIVS21-36del510

BRCA1 c.5333-36_5406+400del in other databases

Reports that look at this variant (1)

These Genome Test condition reports include c.5333-36_5406+400del among the variants they look at.

ReportConditionsInheritance
Hereditary Breast and Ovarian Cancer (BRCA1/2)BRCA1-related cancer predispositionAutosomal dominant

Other variants in BRCA1

All BRCA1 variants

Limitations

This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant.

Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports.

Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements.

If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor.

Sources & credits

  • Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information.
  • Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0.
  • Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16).
  • Allele identifiers from the ClinGen Allele Registry (release 2026-10-16-c4908f54).
  • Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information.
  • Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-16).
  • Difficult regions from the Genome in a Bottle Consortium (release v3.6).
  • Transcripts from MANE (release v1.5), NCBI and EMBL-EBI.
  • Predicted consequences from mehari (release 0.11.0), with transcript models from cdot.
  • Built from Dante Labs data release 2026.10.16-c6eea6bf of 16 October 2026.

Cite this page

APA

Dante Labs. (16 October 2026). BRCA1 c.5333-36_5406+400del (rs1555574977) (Version 2026.10.16-c6eea6bf). Retrieved 16 October 2026, from https://dantelabs.com/genes/brca1/variants/c-5333-36to5406plus400del

Vancouver

Dante Labs. BRCA1 c.5333-36_5406+400del (rs1555574977) [Internet]. Version 2026.10.16-c6eea6bf. 16 October 2026 [cited 16 October 2026]. Available from: https://dantelabs.com/genes/brca1/variants/c-5333-36to5406plus400del

Download citationRISBibTeXCSL-JSON

Read your whole genome

From $449Free shipping · Results in 6–8 weeks

Explore the Genome Test