--- title: "LDLR A697Cfs*6 (c.2085_2103del, rs879255133) | Dante Labs" description: "ClinVar classifies LDLR A697Cfs*6 as Pathogenic (criteria provided, multiple submitters, no conflicts). Where it sits in the genome, its predicted effect, and the Genome Test reports that look at it." url: "https://dantelabs.com/genes/ldlr/variants/a697cfs6" --- 1. [Genes](https://dantelabs.com/genes) 2. [LDLR](https://dantelabs.com/genes/ldlr) 3. LDLR A697Cfs\*6 Variant # LDLR A697Cfs\*6 NM_000527.5(LDLR):c.2085_2103del (p.Ala697CysfsTer6) Also known as - p.Ala697CysfsTer6 - p.A697Cfs\*6 - rs879255133 * ClinVar classification Pathogenic * Review status 2 stars out of 4 criteria provided, multiple submitters, no conflicts * Last evaluated 16 December 2016 Data current to ClinVar release 2026-10-12 · Dante Labs data release 2026.10.17-8666dff2 Facts last changed 17 October 2026 ## Summary A697Cfs\*6 is a frameshift variant in LDLR: it adds or removes DNA letters in a way that shifts how the rest of the gene's code is read. ClinVar classifies it as pathogenic for hypercholesterolemia, familial, 1 (criteria provided, multiple submitters, no conflicts). ## ClinVar classifications | Condition | Classification | Review status | Submissions | Last evaluated | | ------------------------------------------------------------------------------------------------------------------------------------ | -------------- | --------------------------------------------------------------------- | ------------- | ---------------- | | hypercholesterolemia, familial, 1[ClinVar VCV000252209 (opens in a new tab)](https://www.ncbi.nlm.nih.gov/clinvar/variation/252209/) | Pathogenic | 2 stars out of 4 criteria provided, multiple submitters, no conflicts | 3 submissions | 16 December 2016 | Classifications as ClinVar records them in release 2026-10-12. ClinVar updates them as evidence is reviewed. ## ACMG/AMP criteria The ACMG/AMP criteria A697Cfs\*6 meets, from its predicted effect in LDLR, gnomAD and ClinVar. | Criterion | Strength | Rests on | | ------------------------------------------------------- | ----------- | -------------------------------------------------------------------------- | | PVS1 Null variant where loss of function causes disease | Very strong | frameshift_variant on NM_000527.5 | | PP5 A reputable source reports it as pathogenic | Supporting | ClinVar: Pathogenic (criteria provided, multiple submitters, no conflicts) | On these criteria alone: uncertain significance. Assessed automatically, without functional, computational or family evidence. Not a clinical classification. ## Where it lies in LDLR A697Cfs\*6 lies in exon 14 of the 18 in LDLR's MANE Select transcript, NM_000527.5. [LDLR variants in exon 14 →](https://dantelabs.com/genes/ldlr/variants?exon=14) [LDLR's gene diagram →](https://dantelabs.com/genes/ldlr#gene-structure) ## Molecular details | Gene | [LDLR](https://dantelabs.com/genes/ldlr) | | --------------------------- | ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | Transcript | NM_000527.5 MANE Select | | Coding DNA change (HGVS c.) | c.2085_2103del | | Protein change (HGVS p.) | p.Ala697CysfsTer6 p.A697Cfs\*6 | | Predicted consequence | Frameshift [frameshift_variant (opens in a new tab)](https://purl.obolibrary.org/obo/SO_0001589) [frameshift_truncation (opens in a new tab)](https://purl.obolibrary.org/obo/SO_0001910) | | Predicted impact | High | | Position (GRCh38) | chr19:11120465 ACCTGCGCCTGCCCGGACGG>A | | Position (GRCh37) | chr19:11231141 ACCTGCGCCTGCCCGGACGG>A | | dbSNP ID | [rs879255133 (opens in a new tab)](https://www.ncbi.nlm.nih.gov/snp/rs879255133) | | ClinVar Variation ID | [VCV000252209 (opens in a new tab)](https://www.ncbi.nlm.nih.gov/clinvar/variation/252209/) | | ClinVar Allele ID | 246504 | | ClinGen Allele Registry ID | [CA10585763 (opens in a new tab)](https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA10585763) | | ClinVar name | NM_000527.5(LDLR):c.2085_2103del (p.Ala697fs) | ## LDLR A697Cfs\*6 in other databases - [ClinVar VCV000252209 (opens in a new tab)](https://www.ncbi.nlm.nih.gov/clinvar/variation/252209/) - [dbSNP rs879255133 (opens in a new tab)](https://www.ncbi.nlm.nih.gov/snp/rs879255133) - [ClinGen Allele Registry CA10585763 (opens in a new tab)](https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA10585763) - [gnomAD 19-11120465-ACCTGCGCCTGCCCGGACGG-A (opens in a new tab)](https://gnomad.broadinstitute.org/variant/19-11120465-ACCTGCGCCTGCCCGGACGG-A?dataset=gnomad_r4) - [Ensembl rs879255133 (opens in a new tab)](https://www.ensembl.org/Homo_sapiens/Variation/Explore?v=rs879255133) ## Reports that look at this variant (2) These Genome Test condition reports include A697Cfs\*6 among the variants they look at. | Report | Conditions | Inheritance | | ----------------------------------------------------------------------------------------------- | ----------------------------- | ----------- | | [Familial Hypercholesterolemia](https://dantelabs.com/conditions/familial-hypercholesterolemia) | familial hypercholesterolemia | | | [Hyperlipidemia](https://dantelabs.com/conditions/hyperlipidemia) | Hyperlipidemia | | ## Other variants in LDLR - [A399D Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a399d) - [A399T Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a399t) - [A431P Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a431p) - [A431T Pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a431t) - [A540S Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a540s) - [A540T Pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a540t) - [A612Rfs\*50 Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a612rfs50) - [A697P Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/a697p) - [c.1A>C Pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/c-1a-c) - [c.1A>G Likely pathogenic 3 stars out of 4](https://dantelabs.com/genes/ldlr/variants/c-1a-g) [All LDLR variants](https://dantelabs.com/genes/ldlr/variants) ## Limitations This page describes publicly available information about a genetic variant. It is not a diagnosis, and it says nothing about whether you or anyone else carries this variant. Classifications come from ClinVar and change as new evidence is reviewed. A classification here may differ from the one in ClinVar today, or from the one a laboratory reports. Whole genome sequencing with short reads can miss or miscall some variants, particularly in repeated or highly similar stretches of DNA and in large insertions, deletions or rearrangements. If you have questions about a variant in your own results or in your family, talk to a genetic counsellor or your doctor. ## Sources & credits - Classifications from ClinVar (release 2026-10-12), National Center for Biotechnology Information. - Condition terms from the Mondo Disease Ontology (release 2026-10-06), used under CC BY 4.0. - Gene symbols and names from the HUGO Gene Nomenclature Committee (release 2026-10-16). - Allele identifiers from the ClinGen Allele Registry (release 2026-10-17-c4908f54). - Reference SNP identifiers from dbSNP (release b157), National Center for Biotechnology Information. - Gene–disease links from the Gene Curation Coalition, GenCC (release 2026-10-17). - Difficult regions from the Genome in a Bottle Consortium (release v3.6). - Transcripts from MANE (release v1.5), NCBI and EMBL-EBI. - Predicted consequences from mehari (release 0.11.0), with transcript models from cdot. - Built from Dante Labs data release 2026.10.17-8666dff2 of 17 October 2026. ## Cite this page APA > Dante Labs. (17 October 2026). LDLR A697Cfs\*6 (c.2085_2103del, rs879255133) (Version 2026.10.17-8666dff2). Retrieved 17 October 2026, from https\://dantelabs.com/genes/ldlr/variants/a697cfs6 Vancouver > Dante Labs. LDLR A697Cfs\*6 (c.2085_2103del, rs879255133) \[Internet]. Version 2026.10.17-8666dff2. 17 October 2026 \[cited 17 October 2026]. Available from: https\://dantelabs.com/genes/ldlr/variants/a697cfs6 Download citation [RIS](https://dantelabs.com/genes/ldlr/variants/a697cfs6/cite.ris) [BibTeX](https://dantelabs.com/genes/ldlr/variants/a697cfs6/cite.bib) [CSL-JSON](https://dantelabs.com/genes/ldlr/variants/a697cfs6/cite.json) ## Read your whole genome From $449 Free shipping · Results in 6–8 weeks [Explore the Genome Test](https://dantelabs.com/whole-genome-sequencing)